Specific primers used in the current study.
Abstract
Fungal biomass quantification is critical in understanding the interactions between the pathogen and susceptibility or resistance of the host plant as well as identifying competition between individual fungal spp. in disease progression. In the present chapter, two maize lines grown in different climatic regions of Kenya were infected with an aflatoxigenic A. flavus isolate (KSM014) and fungal colonization of the maize plant tissues was monitored by measuring fungal biomass load after 14 days in a controlled environment. The objective of the study was to determine whether the maize line colonized was a factor in increasing or limiting the growth of an aflatoxigenic strain of Aspergillus flavus.
Keywords
- fungi
- Aspergillus flavus
- aflatoxins
- maize lines
1. Introduction
Fungal biomass quantification is critical in understanding the interactions between the pathogen and susceptibility or resistance of the host plant in identification and competition in individual species of fungi in diseases progression [1].
The quantification and detection of biomass of fungi in plant host tissues have been conducted using polymerase chain reaction methods [2, 3]. Some authors, Sanzani et al. [2] showed that, the sensitivity of quantitative polymerase chain reaction (qPCR) can be applied to measure infections at very low volumes, thus, corresponding to the quantity of the pathogen that might be present during the latent or time of and or at asymptomatic infections. qPCR also enables the evaluation of stages of infection in plant tissues and the quantification of a fungal pathogen throughout the entire disease cycle [2].
Coninck et al. [1] developed a qPCR assay for detection and quantification of
Mayer et al. [9] and Jurado et al. [10] used single copy mycotoxin biosynthetic genes to develop PCR assays for detecting mycotoxigenic fungi. Assay sensitivity increased when ITS1 and ITS2 spacer regions were included as, these regions have sufficient variability to enable discrimination of closely related species in the genus
The objective of this study was to develop a sensitive, specific qPCR assay for quantifying
2. Materials and methods
2.1 Cultures of fungi
The aflatoxigenic
2.2 Maize cultivars
GAF4 maize lines and KDV1 varieties were obtained from Kenya Agricultural and Livestock Research Organization (KALRO), Kenya. The selection of the varieties are focused mainly on their drought tolerance and the agro-ecological zones in which they were grown. Striga tolerant variety (GAF4) is produced by KALRO Kibos, Kisumu County. GAF4 is cultivated in Homa Bay, Kisumu and Busia counties [15]. The Kenya Dryland Varieties 1 is an open pollinated hybrid recommended for medium to low altitude areas. KDV1 is drought tolerant, matures early and produce flowers after germination between 45 and 52 days. It is mainly cultivated in Homa Bay and Makueni regions (http://drylandseed.com).
2.3 Media preparation and reagents
Phytagel, Nicotinic acid, Glycine, Thiamine hydrochloride, Murashige and Skoog medium (MS), Potassium hydroxide, Pyridoxine hydrochloride and Myo-inositol were from Sigma-Aldrich (USA). MS vitamins; 5 g myo-inositol, 500 mg Thiamine-HCl, 500 mg pyridoxine-HCl, 250 mg nicotinic acid and 100 mg glycine were filter sterilized after preparation in distilled water and thereafter stored at −20°C according to the instructions of the manufacturer’s (Sigma-Aldrich, USA). The modified MS media was briefly prepared, 2.15 g MS salt was dissolved in sterile H2O, thereafter, 10 ml MS vit. added and pH 5.7 adjusted using 1 M KOH and volume further adjusted to 1 l using sterile H2O. 5 g of phytagel was added to MS media and heated in microwave to dissolve the salts. Fifty milliliters of the media was dispensed into tissue culture bottles, autoclaved and thereafter, cooled in the level 2 biosafety cabinet for approx. 1 h prior to inoculations as previously described [14].
2.4 Seed sterilization and Aspergillus flavus infection
The seeds were sterilized in a biosafety cabinet, level 2 [Contained Air Solutions (CAS) BioMAT2, UK]. Twenty milliliters of 95–100% ethanol was used for sterilization of viable seeds for 1 min and briefly shaken for 15 s. The alcohol was replaced with 20 ml of sodium hypochlorite (2.5%). After 15 min of reaction at room temperature, the mixture was shaken for 30 s and thereafter, the liquid discarded. 30 ml of sterile H2O was used 5× to wash the seeds with intermittent shaking after every wash. 50 ml of sterile H2O was added and left to stand for 1 hr at rmt. The H2O was replaced with 20 ml of 2% Tween 20 and shaken for 30 s. Conidia suspensions adjusted to 1 × 106 conidia ml−1 using a hemocytometer was used to inoculate the seeds. The seeds in the tubes were para filmed after sealing and kept for 30 min in a shaking incubator at 30°C. Controls were treated with sterile H2O instead of spores of conidia and thereafter, incubated following the same conditions. The seeds were left to dry in Petri dishes after inoculations overlaid with filter paper overnight (Whatman No. 1). The seeds were germinated in a plant growth chamber, Conviron (Winnipeg, Manitoba, Canada) set at 28°C after subsequent inoculations onto tissue culture bottles. The germination and growth were observed for a 14-day period, tissues of the plant (roots and shoots) were separately harvested, flash frozen in liquid nitrogen prior to DNA/RNA extraction and stored at −80°C.
2.5 The extraction of gDNA from maize tissues and Aspergillus flavus
A 100 mg of each of the following samples: control healthy maize tissues, infected and
2.6 Designing of primers
Sets of 3 primers (Table 1); elongation factor 1 alpha (
Primer name | Forward primer (5′-3′) | Reverse primer (5′-3′) | Product size (bp) | Ta | Reference |
---|---|---|---|---|---|
Membrane Protein ( | TGTACTCGGCAATGCTCTTG | TTTGATGCTCCAGGCTTACC | 203 | 64 0 C | Manoli et al. [17] |
Elongation Factor 1 alpha ( | CGTTTCTGCCCTCTCCCA | TGCTTGACACGTGACGATGA | 102 | 62 0 C | Nicolaisen et al. [5] |
TCTTCATGGTTGGCTTCGCT | CTTGGGTCGAACATCTGCT | 118 | 62 0 C | Mitema et al. [18] |
2.7 PCR amplification
Conventional polymerase chain reaction amplification was carried out in volumes of 25 μl and consisted of 0.5 μl of 10 μM dNTPs (Bioline), 10× reaction buffer with MgCl2, 1 μl of 10 μM forward and reverse primers, 0.2 μl Kapa Taq, 1 μl of 10 ng DNA template, and sterile H20. Protocol performed and followed for cycling conditions were: 1 cycle for 5 min at 94°C followed by 35× (for 30 s at 94°C, for 45 s at 60°C, for 90 s at 72°C). Elongation step was achieved at 72°C for 7 min and finally at 4°C for 1 min. The products of PCR were assessed on 2% agarose/EtBr gel in TAE1 X buffer (Tris–acetate 40 mM and EDTA 1.0 mM). Fermentas (100 bp DNA ladder) was used as a molecular size marker.
2.8 Standard curves and fungal quantification
Ten-fold serial dilutions of pooled 10 ng gDNA extracts from
The quantity of targeted DNA in an unknown sample was inferred from the respective std. curves.
Ten nanograms of DNA isolated from infected and healthy maize roots and shoots respectively were used to assess primer specificity. For the exclusion of false negative results, template DNA samples from fungi were assessed for polymerase chain reaction amplification with primer pairs
The quality and integrity of the isolated DNA, samples from infected and control tissues of the maize, and saprophytic fungi were subjected to polymerase chain reaction analysis with the reference genes under the following amplification conditions: for 10 min at 95°C; 35 cycles for 3 s at 95°C, for 20 s at 64°C, for 1 s at 72°C for
2.9 Statistical analysis
The statistical analysis was performed as previously described [14].
3. Results and discussion
3.1 Gene specificity and qPCR assays
To our knowledge, a qPCR assay for the detection and quantification of
In this study, the qPCR assay was developed to specifically detect and quantify
Amplification of the MEP gene (203 bp) was used to detect maize DNA, while amplification of
3.2 Colonization of plant tissues by Aspergillus flavus
The observed phenotypic characteristics were further supported by the detection and quantification of fungal biomass load in gDNA extracted from infected and control plant tissues as revealed by the qPCR assay (Figure 3).
Insignificant difference was observed in biomass of fungi between infected plant tissues for the GAF4 and the control maize line (Figure 3a). In contrast, significant differences in biomass of fungi for the KDV1 maize line was exhibited upon infection (p < 0.05) for both the shoot and root tissue (Figure 3b). Fungal gDNA level was observed to be lower in the infected GAF4 maize line tissues compared to KDV1 suggesting that GAF4 was more resistant to
The fungal biomass of
It must be noted that we measured fungal biomass 14 days after infection when symptoms of the infection was phenotypically visible. However, other fungal biomass studies have shown that specific fungi could be identified even before the development of the symptoms. The presence of
GAF4 is a
The current study relates to the previous findings on Makueni maize samples [18] where they screened the strains of
Moreover, the current study developed a qPCR assay using
The genomic DNA extracted from the co-infected shoots of both maize lines showed varied concentrations of fungal biomass load compared to the roots according to analysis using 1-way ANOVA and TMCT test (p < 0.05). The quantification of
4. Conclusion
The study demonstrated that KDV1 maize line was more susceptible to
The
The next chapter will focus on in vitro biocontrol approach in aflatoxin mitigation and bio-analytical approaches to detect and quantify aflatoxins. The aim is to determine whether biocontrol can minimize aflatoxin production and to find important metabolites that are produced by specific
Acknowledgments
The work was supported by the University Science, Humanities and Engineering Partnerships in Africa (USHEPiA) Fund and South African Bio-Design Initiative (SABDI) grant number 420/01 SABDI 16/1021. Also, the authors acknowledge the University of Nairobi, Kenya and Vaal University of Technology, Vanderbijlpark, South Africa for providing laboratory space and funding.
Conflicts of interest
The authors declare no conflict of interest. The authors are responsible for the content and writing of the paper.
Authors contribution
Data curation, Alfred Mitema; Formal analysis, Alfred Mitema and Naser Aliye Feto; Funding acquisition, Nasesr Aliye Feto; Investigation, Alfred Mitema; Methodology, Alfred Mitema and Naser Aliye Feto; Resources, Alfred Mitema and Naser Aliye Feto; Validation, Alfred Mitema; Writing—original draft, Alfred Mitema; Writing—review & editing, Alfred Mitema and Naser Aliye Feto.